Welcome to How To Grow (almost) Anything in GaudiLabs - Switzerland |
 |
GaudiLabs are creative spaces for working, thinking and living where culture and technology meet. We conduct open research in open source culture technology. Developing methods, process and devices to unite people and knowledge from different fields and backgrounds.
Participants:
Urs
Gaudenz is
micro-engineer and founder of
GaudiLabs.
He worked for Swiss high tech companies in the field of
micro sensor technology and brushless motor control. With his solid
background in electronics, mechanics and software he is working in a
concurrent style between the disciplines. After several years of
experience as a consultant in innovation management he is now engaged
as lecturer for product innovation at the Lucerne University of Applied
Science and Arts. For more than 5 years he is an active member
of the
global biohacking movement and in particular the hackteria.org global
network. His works include a DIY-bio-printer,
a Mobile
Gen Lab and the
development of the OpenDrop
a first prototype for a digital bio lab
based on electro wetting technology. For more information see
www.gaudi.ch
and www.hackteria.org 
Stefan
Deuber studied molecular biology at the
Swiss Federal Institute of Technology (ETHZ) in Zurich. After finishing
his PhD in molecular Virology he joined a small biotech start-up as an
early employee and helped building the company and technology. Besides
optimizing existing company technology such as ribosome display,
directed evolution, cell-free systems, selections & screenings
and protein expression & purification, he was responsible to
setup and and run the mammalian cell culture facility.
After several years working in the industry he was caught by the desire
to look out for alternatives to growing biotech / big pharma. Thereby
he got interested in the field of DIY biology and also came in contact
with hackteria.org.
In addition to biology, he is interested in
community organizations and is running the largest Swiss Lindy Hop
(swing dance from the 20/30ies) dance school in Zurich
(downtownswing.ch).
To round up the broad interests, he is also working as a photographer
specialized in stage/concert/theatre/opera photography
(stefandeuber.com).We are associated with the FabLab Lucern.
FabLab Lucern was founded in 2011 as the first fablab in Switzerland and is located on the campus of the Lucerne University of Applied Sciences and Arts. The fully equipped FabLab on two floors with more than 100 square meters working area is frequently used by students and people from the area. FabLab Lucern is happy to join the HTGAA Academy as an institutional partner together with GaudiLabs.
Special Thanks to
our Sponsor Zukunftslabor
CreaLab.
The interdisciplinary research project CreaLab of the Lucerne
University explores, creates and promotes conditions, processes and
methods for creating new, innovation and change. Class assignments:
Class 1: Three aspects of lab safety and best practice.Class 2: DNA Nanostructures
Class 3: Synthetic Minimal Cells
Class 4: Next Generation Synthesis
Class 5: Bio-Production
Class 6: Darwin on steroids
Class 7: Genome Engineering
Class 8: In Situ Sequencing
Class 9: Synthetic development biology
Class 10: Biofabrication and additive manufacturing
Class 11: Evolution, CRISPR Gene Drives, and Ecological Engineering
Class 12: Engineering the Human Gut Microbiome
Class 13: Computational protein design, biosensors and the protein-folding game
Class 15: Tool Chains, Automation, and Open Hardware
Final Project: Setting up a microbiological lab
Addition website by Stefan Deuber.
Various
Favorites on HTGAAGuests on HTGAA
Three aspects of lab safety and
best practice 
Make up your own
rules that you understand and want to
respect. Start
with a short list of rules you know and add more as you learn. Observe
how other people and other labs work and adopt what you think is
relevant for you. Think of what you learned from your parents as a
child
(kitchen).1. Respect the environment and the creatures
- make clever designs
- produce only little (no industrial production of badly designed organisms)
- democratize the knowledge of synthetic biology
- be open with your ideas, projects, discuss with others and respect their opinion
- wear goggles and gloves
- label things
- do not work alone in the lab
- do only buy small quantities
- if you can use the more safe option (chemicals), do so
- respect local laws and regulations
- clean your working bench
- only open containers as shortly as possible
- work with a flame or a fume hood
- sterilize your tools with a steam cooker or UV light or chemicals
Official local laws in Switzerland:
On the website of the Swiss National Confederation guidelines and references to laws (Einschliessungsverordnung, ESV; SR 814.912) on working with genetically modified and pathogenic organisms can be found.
http://www.bafu.admin.ch/biotechnologie/13475/index.html?lang=de
http://www.bafu.admin.ch/biotechnologie/index.html?lang=de
To get a permission for our lab we need to fill out an online form specifying what the purpose of our experiments are (education) and what organisms we plan to work with.
https://www.ecogen.admin.ch/wiki/index.php?title=Globalmeldung/de
A list of organisms and their classification is provided:
http://www.bafu.admin.ch/publikationen/publikation/01614/index.html?lang=de
Part of the application process is to designate a Bio Safety Officer. Guidelines can be found here:
http://www.bafu.admin.ch/publikationen/publikation/00597/index.html?lang=de
On the DIYBio website there is a special section where you can ask questions (and see previous questions) to bio safety officers:
http://ask.diybio.org/
Global laws & rules
Each country has it's own regulations and laws when it comes to use of synthetic biology. Also these laws are often revised or lagging behind the current state of the art. Generally most counties know laws to 1. protect the employees 2. to protect the nature.
Also quite general there are different "Bio Safety Levels (BSL).
BSL-1 This level is suitable for work involving well-characterized agents not known to consistently cause disease in healthy adult humans.
BSL-2 This level is similar to Biosafety Level 1 and is suitable for work involving agents of moderate potential hazard to personnel and the environment. It also applies to working with unknown microbes found in nature.
BSL-3 This level is applicable to clinical, diagnostic, teaching, research, or production facilities in which work is done with indigenous or exotic agents which may cause serious or potentially lethal disease after inhalation
BSL-4 This level is required for work with dangerous and exotic agents that pose a high individual risk of aerosol-transmitted laboratory infections, agents which cause severe to fatal disease in humans
Source: https://en.wikipedia.org/wiki/Biosafety_level
DIYBio Code of Ethics (US and EU)
Click to see bigger.
Source: http://diybio.org/codes/
DNA Nanostructures
How to design nano structures in CadNano and export the DNA sequences that then can be folded to the nano designs.
Rothemund Rectangle designed in CadNano
Generated DNA sequences. Staples with and without dumbbells.
Download the raw files in ZIP format here:
Also included in the ZIP is a excel sheet to design patterns that outputs the sequences with dumbbell insertion .
Lab Experiement:
Hint on how to pipette DNA nano structures. Layout the picture in the pipette tip box to transfer the staple DNA from the well plate. Best use a multi (8x) pipette (if you have one :-).
| Lab Equipment: Express GFP in cell free system | ||
| Tools | ||
| - multi pipettor (12x) |
donation? | |
| - pippette tip box | Make | |
| Wet ware | - staple strands (oligos) | Barcelona? |
| - Buffer | ? | |
Getting ready to order DNA - http://www.microsynth.ch/
The pooling of orders for DNA strands did not happen yet. That could be a nice resource for an open wet ware store in the future.
Also we would need access to an Atomic Force Microscope. We looked at some DIY AFM. Unfortunately not one seems to be completely DIY yet. .
There is a KIT, called "Stromlinenet Nano" - does not seem to be open source and quite expensive at $2999.
Then rather get the real deal from NanoSurf.
More info on DIY AFM here.
Synthetic
Minimal Cells
Two ways, cell free expression systems and synthetic minimal cell.Minimal cell mainly consist of:
- cell, membrane, capsule, vesicles (semi permeable, isolating enzyme)
- machinery, mainly transcription
Advantage of cell free systems:
- Faster, easier, just DNA no Plasmid needed
- No interference with cell, cell not digesting enzymes
- Special chemicals possible
- purification difficult
- make experiments under more controlled condition
- Molecular crowdiness matters
- geometric arrangement matters (simulated by scaffolds)
Questions:
- if it safe use outside of lab?? Ultimate Biodegradable, can release it.
- possible to grow the minimal system in cells??
Building blocks:
Amino Acids
Energy ATP
Enzymes
Two approache to get Tx/Tl systems
1. Cell extract
2. Machinery of Pure System (synthesized): Set of Enzymes (36) and small molecules,
no correction system -> high protein production yield but extra non wanted expressions
Different systems (extracted) yeast?
- E. coli
- Wheat germ
- Insect
- Rabbit
- Human
Applications
- Biosensors (in environment / in body)
- Protocells: study the origin of life
- Biotech, screening, protein engineering, synthesis of small molecules
Assignment on "Design Guideline"
---------------------------------------------Measuring Arsenite using Minimal Cell reporter
Induction of luminescence shown by cell-free culture fluids from other bacteria.
«Cross-species induction of luminescence in the quorum-sensing bacterium Vibrio harveyi»
BONNIE L. BASSLER,1* E. PETER GREENBERG,2 AND ANN M. STEVENS3
1. Pick a function
Use synthetic minimal cell as reporter for arsenic contaminated water. System is known from arsenic reporter GMO based on ecoli (see biodesign.cc). An advantage of using minimal cell would be to avoid regulatory problems with using GMO in the field. The GFP could further be replaced by using Vibrio harveyi as luminescent reporter. The Vibrio bacteria could be triggered through quorum sensing mechanism.
1A Function
ex. interfacing with natural cell
Fluorescent protein (GFP) or Vibrio harveyi luminescence
1B Transcription / Translation
ArsR reporter, repressor protein binds to the DNA and inhibit synthesis
1C Will it work in natural cell
Yes. Has been shown before.
2. Design all components (inside): Input / Output
2A Membrane: Phospholipids
Unclear if passive transport through membrane happens - otherwise active transporter system needed.
2B What inside
- coupled TX/TL system
- purified N-Acyl homoserine lactone (AHL)
- pore-forming DNA under ArsR-regulated promoter
2C What cells: bacteria, yeast (in future)
- E.coli
2D How communicate
- see 2A
-> drawing
3. Experimental details
3A
for production of purified AHL
- complete AHL biosynthesis pathway (Acyl-homoserine-lactone synthase (existing in a number of bacterial species)
3B
- measurement of fluorescence for GFP reporter
- luminescence quantification when Vibrio harveyi is used
Detection through DIY fluorimeter. UV LED, filter and photosensor.
Question / Answer:
How will the arsenate be transported into the vesicles?
Using naturally luminescent cells in combination with Synthetic Minimal Cells?
It's a great approach with potentially many new applications. Using chemicals as a trigger.
Could a minimal cell system be used without limitations that cover GMO?
Synthetic minimal cells count as chemicals so the laws for GMO do not applicate. Since these cells do not replicate.
One limitation might be horizontal gen transfer. If some bacteria would pick it up that might be a limitation.
Can minimal cells replicate (like sporing)?
Has probably not been done yet. Would be cool.
Are there any naturally occurring minimal cells?
Two approaches:
Bottom up: assemble minimal cells from selected parts.
Top down: Reduce ecoli. to get a minimal cell.
Links:
http://biodesign.cc
Additional Idea:
Biosensor to detect allergenic enzyme of dust mite.
(The group III allergen from the house dust mite Dermatophagoides pteronyssinus is a trypsin-like enzyme.
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1384798/)
Lab Experiment:
| Lab Equipment: Express GFP in cell free system | ||
| Tools | ||
| - fluorimeter |
OK | |
| - vortex | Make | |
| - tubes | ? | |
| Wet ware | - Cell free Tx/Tl system developed by Vincent Noireaux | Barcelona? |
| - GFP vector | ? | |
| - vector: pIVEX-SNAP-GFP | ? | |
| - PURExpress In Vitro Protein Synthesis Kit | ? | |
The shipping cost of the minimal cell (cold shipping) to Europe was too expensive, so we could not do the lab experiments yet. We really would like to work with it in the future if a pooled order can be arranged.
Next Generation Synthesis
Today
(2015) it is possible to sequence a whole human genome in a desktop
size sequencing machine at a cost of 1000$ (HiSeq
X Ten).
The first human genome took 10 years and cost about 3 billion dollars
to be read. However the cost of synthesizing DNA did not drop as much
yet. The annual global gene synthesis is only 250 Mbp (Mega base pairs)
or about 1/12th of a human genome. If the cost of DNA synthesis was
lower it would be more affordable to use the genetic data on GenBank
(that today covers 260'000 Organisms) to synthesize specific
enzymes. So the race for cheaper synthesis is still going. Next
generation technologies combining the highly developed silicon chip
technology with gen synthesis are promising. Different approaches using
micro arrays and optical systems have been proposed or developed.Longer gen sequences are synthtisized in shorter length (oligos) and then assembled into longer chains. The gen synthesis is error-prone and different error correcting mechanism must be used (like HPLC).
Assignment on Primer design and Gene Synthesis
(Primer design to linearize plasmid backbone)
Basic
rules for manual PCR primer design:- Primers are always specified 5' to 3', left to right.
- Primers should be 20-30 nucleotides in length
- Primers should have a GC content of 40-60%
- Primers should have a melting temp (Tm) of 55-65°C
- Primer pairs should have similar annealing temperatures
- Avoid runs of over 3 nucleotides (i.e., CCCC).
...see here.
upstream is toward the 5' end of the coding strand (right to left, toward smaller number, direction of arrow)
So let's try to:
Design a 18 bp priming sites that amplify a ~2.25 kb region of pUC19 immediately upstream of the Plac promoter and downstream of the start of lacZalpha. pUC19 is a commonly used E. coli cloning vector.
Where is the Plac promoter ? bp: 514..519 TATGTT or 538..543 TTTACA?
Where is lacZ alpha ? bp: 146..469 or "misc_feature" 396..452?
What is a lac operon?
So let's go for 146-543, 2289 bp
543 downstream region (40bp): caattccacacaacatacg agccggaagcataaagtg taa
146 upstream region (40bp): ctatgcgg catcagagcagattgtactgagagtgcaccat
There is software to generate primers, so let's use PerlPrime:
That's what we get as good primer set:
Forward Primer: (5') AGCCGGAAGCATAAAGTG (3') (Tm: 57.8°C)
Reverse Primer: (5') CCGCATAGTTAAGCCAGC (3') (Tm: 58.7)
Forward vs. Forward: -0.04 kcal/mol
5' AGCCGGAAGCATAAAGTG 3'
||.....||
3' GTGAAATACGAAGGCCGA 5'
Forward vs. Reverse: -0.17 kcal/mol
5' AGCCGGAAGCATAAAGTG 3'
||.||...........|
3' CGACCGAATTGATACGCC 5'
Reverse vs. Reverse: -2.91 kcal/mol
5' CCGCATAGTTAAGCCAGC 3'
||....||||....||
3' CGACCGAATTGATACGCC 5'
NUPAC says:
Forward primer: 50% GC, Free energy of secondary structure: -1.90 kcal/mol
Reverse Primer: 55% GC, Free energy of secondary structure: -0.80 kcal/mol
Poor primer:
Forward Primer: CTATGCGGCATCAGAGCAG, Free energy -3.2 kcal/mol (53.2°C)
Reverse Primer: CTGCTCTGATGCCGCATA, , Free energy -2.2 kcal/mol (50.3°C)
Build a gene from shorter gene synthesis fragments
We want to build a fluorescent reporter from gene fragments using Gibson Assembly. Reporters are mechanism to display an information by expressing a proteine that can be made visible. There are different types of reporters: Chromoproteins, Fluorescent proteins and Luciferases.
We go for the "IP-Free Fluorescent protein" BBa_J97001 (JuniperGFP, Green Fluorescent Protein).
The sequence that we want to assemble is:
>BBa_J97001 Part-only sequence (702 bp):
atgtcgtctggtgcactgttgtttcatggtaaaatcccgtatgttgtagaaatggaaggcaatgtcgatggtcacacctttagcattcgcggcaagggttacggtgacgcgagcgttggtaaggtcgacgcgcagtttatctgcaccacgggtga
cgtcccggtgccgtggagcacgttggtgacgacgctgacttacgg tgcccaatgtttcgcgaaatatggcccggggctgaaagacttctacaaatcctgtatgccggaaggttatgtgcaagagcgcactattacctttgagggt gacggtgtctttaagacccgtgccgaagtgaccttcgaaaacggtagcgtttacaaccgtgtcaagctgaatggccagggtttcaaaaaggatggtcacgttctgggtaagaatctggaattcaacttcaccccacactgcctgt
acatctggggcgatcaagcgaatcatggtctgaaaagcgcatttaagatcatgca cgagattaccggctccaaagaagatttcatcgtggctgatcacacccagatgaataccccgattggcggtggccctgtgcacgttccg
gaatatcatcacctgaccgtctggacgagcttcggtaaggatccggatgacgacgaaaccgaccacctgaacatcgtagaggttatcaaagcagtggacctggagacgtatcgc
From IDT we can order fragments of 251-500 bp for 98.00 CHF.
We need to design 3 DNA fragments of approx 234bp length with 15-30 bp overlap.
We used NEBuilder to design the three segments:
Fragment 1:
atgtcgtctggtgcactgttgtttcatggtaaaatcccgtatgttgtagaaatggaaggcaatgtcgatggtcacaccttt
agcattcgcggcaagggttacggtgacgcgagcgttggtaaggtcgacgcgcagtttatctgcaccacgggtgacgt
cccggtgccgtggagcacgttggtgacgacgctgacttacggtgcccaatgtttcgcgaaatatggcccggggctg
Fragment 2:
aaagacttctacaaatcctgtatgccggaaggttatgtgcaagagcgcactattacctttgagggtgacggtgtctttaag
acccgtgccgaagtgaccttcgaaaacggtagcgtttacaaccgtgtcaagctgaatggccagggtttcaaaaaggat
ggtcacgttctgggtaagaatctggaattcaacttcaccccacactgcctgtacatctggggcgatcaagcgaat
Fragment 3:
catggtctgaaaagcgcatttaagatcatgcacgagattaccggctccaaagaagatttcatcgtggctgatcacaccc
agatgaataccccgattggcggtggccctgtgcacgttccggaatatcatcacctgaccgtctggacgagcttcggtaa
ggatccggatgacgacgaaaccgaccacctgaacatcgtagaggttatcaaagcagtggacctggagacgtatcgc
For assembling the 3 fragments, 15 minute incubation times are sufficient. For assembling 4–6 fragments, 60 minute incubation times are recommended.
The reaction has been optimized at 50°C,
The assembled DNA molecule is covalently joined and may be PCR-amplified.
Lab-Experiment!
PCR amplification using optimal/poor priming sites. Readout with agarose gel.
What we need:
| Lab Equipment: For PCR | ||
| Devices | ||
| - PCR Thermocycler | OK | |
| - PCR eppendorf tubes (0.2 ml, flat top) | Sachiko | |
| - Gel-Box | OK | |
| - Pipettes | OK | |
| - Pipette tips | Sachiko | |
| - Gloves | Sachiko | |
| - **we need a** Fridge, min -20°C | buy | |
| For Expression | ||
| - pUC19 (NEB) |
OK | |
| - DNA Oligos (IDT) | Microsynth | |
| - Vent(exo-) DNA Polymerase (NEB) | ? | |
| - Phusion(exo+) DNA Polymerase (NEB) | ? | |
| - PCR master mix | Mac? | |
| - Water (this special water, what was it) | ? | |
| Lab Equipement: For Expresion | ||
| Tools | ||
| - Shaker and Incubator | OK | |
| - Petri-Dish | OK | |
| - Turbidity meeter | OK | |
| - Tubes with round bottom ~15ml (falcon) | Sachiko | |
| - Sample tubes with screw top | Sachiko | |
| Wet ware |
- Ecoli |
OK |
| - LB, Agar | OK | |
| - Ampicilin | Sachiko | |
Protocols
- plasmid isolation / mini-prep (Qiagen / Boiling-lysozyme method / non-ionic detergent / homebrew alkaline-lysis)
- competent bacteria (TSS method)
Stefan working in the GaudiLabs, and how to make a quick and simple glas loop for spreading culutres on agar.
| Ecol Starter Culture | ||
 |
 |
 |
| Ecoli Starter Culture on Malz Agar | 1:1 (no dilution) | 1:10 (dilution) |
 |
 |
 |
| Ecoli Starter Culture on Bouillon | 1:1 (no dilution) | 1:10 dilution |
Growing Ecoli stock for further experiments. / How to shock freeze ecoli in DIY (click to see video).
Protocols and
resources:Inoculating a Liquid Bacterial Culture - https://www.addgene.org/plasmid-protocols/inoculate-bacterial-culture/
Creating Bacterial Glycerol Stocks for Long-term Storage of Plasmids - https://www.addgene.org/plasmid-protocols/create-glycerol-stock/
LB and LB agar recibies: Protocols/LBAgar.txt
How to shock freeze cultures in DIY with a cold spray - Video
Bio-Production - isn’t just about microbes in a tank
Metabolic
engineering can be used to turn a feedstock into desired products
through fermentation. For this people in companies like Ginko Bioworks
(the Organism Company) design, build and test new pathways in microbes.
A central challenge is that pathways are controlled by myriad
regulatory systems, for example transcription factors and promoters.
The design is not as straight forward as designing a technical device
as
the complexity of living cells far surpasses the complexity of
human-made devices [1]. A combination of "rational approach" and
"rationally irrational approach" with trial and error approach using
selection and evolution is thus required for the design. A systems
approach to biology is used to leverage and optimize the pathways on
all
levels of cellular control including Genomics, Transcriptomics,
Proteomics, Metabolomics and Fluxomics [2]. Assignment: Design a biosynthetic strategy for a compound of your choice
As
for now we were designing with 3D printers and laser cutters rather
than growing our products. To make the link we want to see if
it is
possible to biosynthetize Polylactide polymers or Polylactic
acid, better known as PLA,
the plastic often used in DIY 3D printers. PLA is one possible
substitution of petroleum derived polymers and in 2010 had the second
highest consumption volume of any bioplastic
of the world. The first paper on using yeasts for lactic acid production was published in 1994 by Dequin and Barre. So there is already a history of research that we can base on [3], [4]
1. What chassis and pathway will you use?
Generally bacteria or fungi could be used.
- lactic acid bacteria (LAB)
- rhizopus oryzae
Since we have a lot of cheese in Switzerland, Lactobacillus helveticus would be great for the production of lactic acid from lactose and concentrated cheese whey (Käsemolke) [5]
2. How will you measure product formation?
Hmm, do not know yet. PH measurement?
When the bacteria do the polymerization, small pallets of plastic can be seen inside.
3. What chassis enzymes would you modify?
General process: Renewable resources (glucose) > Fermentabl carbohydrates > Fermenthed broth
Transform starch directly to L(+)-lactic acid
Pathway:
Glucose
\/
Glucose-6-P
\/
Fructose-6-P
\/
Fructose-1,6-bisP
\/
Glycraldehyde-3-P <-> Dihydroxyacetone-P
\/
2 Pyruvate
\/
2 Lactate
Do not quite understand yet... Source: [5]
Natural lactic acid bacteria produce lactic acide so basically no genetic modification is needed to bio-produce it.
To get pure D(–)- or L(+)-lactic acide gene replacement may be necessary (in L. helveticus)
Q&A with Patrick Boyle:
Polymerization
To make a polymer (plastic) the lactic acid must be processes into Lactide Monomers and then polymerized into Polylactic Acide (PLA) [6]
It seems to be possible to do the polimerization by bioproduction too.
Notes:
- Lactic acid is fermentation metabolite generated by certain microorganisms (it is not a milk component).
- Lactic acid can be produced by either microbial fermentation or chemical synthesis.
- D(–)- or L(+) designate direction of specific rotation of chiral compounds.
- By chemical synthesis DL-lactic acid is produced from petrochemical resources.
- Yield of glucose to lactic acid 0.96
- Recently, strains used in the commercial production of lactic acid has become mostly proprietary.
- Purification is not easy.
- NASA is working on a similar project to bring renewable resouce to space.
References:
[1] Parts pluspipes:Syntheticbiologyapproachestometabolicengineering
Patrick M.Boyle a, PamelaA.Silver a,b,n
[2] Systems biology of industrial microorganisms.
Papini M1, Salazar M, Nielsen J.
[3] 16 years research on lactic acid production with yeast - ready for the market?
Sauer M1, Porro D, Mattanovich D, Branduardi P.
http://www.ncbi.nlm.nih.gov/pubmed/21415900
[4] Biotechnological Production of Lactic Acid and Its Recent Applications
Young-Jung Wee1, Jin-Nam Kim2 and Hwa-Won Ryu1
http://www.researchgate.net/publication/228357901_Biotechnological_production_of_lactic_acid_and_its_recent_applications._Food_Technol_Biotech
[5] A.W. Schepers, J. Thibault, C. Lacroix, Lactobacillus helveticus growth and lactic acid production during pH-controlled
batch cultures in whey permeate/yeast extract medium.
[6] PLA Synthesis. From the Monomer to the Polymer, Kazunari Masutani and Yoshiharu Kimura*
http://pubs.rsc.org/en/content/chapterhtml/2014/bk9781849738798-00001?isbn=978-1-84973-879-8#sect539
Starting Bio-Production at GaudiLabs
To start the bio production of oligos, enzymes and other chemical compounds we first build incubators to grow organisms. We also designed a new DIY orbital shaker to keep our bacteria well. We are currently growing E-Coli, algae, daphnia and paramecium.
DIY Orbital Shaker and laser cut incubator.
Darwin on steroids: Bio design, diversity & selection
"Focused Evolution" by designing mutation and selection.
Assignment on "Human Genome Project 2.0”
Human Genome Project 2.0. - ENCODE stands for 'The Encyclopedia of DNA Elements', the project seeks to move science beyond simply telling us what the human genome looks like to telling us how it works and this is what each part does. [1] (Goal: identify all regions of transcription, transcription factor association, chromatin structure and histone modification in the human genome / synthesis of human-scale genomes)
(1) If humanity were to undertake such a project, what would be the benefits? What types of new science and engineering would be enabled if we had such a synthetic human genome? Please provide specific examples
-
442 researchers from various scientific fields working together- find switches that turn genes on or off, influences in genes activity (even at distances), find out when and how DNA is folded and packaged.
- find out what the "'junk" part of DNA is good for (only 1.5 % codes directly for the production of proteins)
- potential applications: regenerative medicine, aging, synthetic higher-level organisms, "gen-updates"
(2) Conversely, why might we not want to proceed with such an endeavor? What are the risks?
Biological systems are so extraordinarily complex and interconnected. Can an analytic approach help to understand the complex system. If evolution is optimizing in a holistic way, will we not lose information by isolating events and dependencies. Why not look at general questions in a more holistic (stochastic) way. Such as combinatorial testing, directed evolution?
(3) Map out a technical strategy for synthesizing a human genome. What technologies would be required? What are existing tools we could leverage? For certain tools that do not exist, what should their capabilities be?
- "rapid, low-cost DNA synthesis" - Next generation synthesis + error correction
(desktop synthesizer market (as a core tool of synthetic
biology)?)- Multiplex Automated Genomic Engineering (MAGE)?
- Big amount of genetic material must be studied
- Big computing power (project so far generated 15 trillion bytes of raw data)
- machine learning, artificial intelligence / 'virtual machine'
[1] Human Genome Project 2.0
https://sciencenode.org/feature/human-genome-project-20.php
Picture: ENCODE explained / MAGE implementation
We now have a decent Eppendor 5417R centrifuge. Got it for 150 CHF at Smiples.
Genome Engineering
Lecture by John Glass on Genome Scale Engineering from the J.Craig Venter Institute (JCVI). The institute in know for having created the first living organism with a completely synthetic genome. The goal is still to design genomes in a computer and assembled them in cell to eventually reproduce fully functional living creatures. Would this then be artificial life? And what does it take to make such a code? How about all the cell machinery, enzymes, membranes, mitochondrai, ribosomes, microtubule and filaments? And what was first, the DNA or the cell? Wiill a minimal genome produce a minimal organism?
Mycoplasma genitalium is a small parasitic bacterium that lives in the genital and respiratory tracts of primates. It has the smallest genome (total genetic material) of all known living organisms. With it's "only" 468 genes it should be a good candidate for a Minimal Microbial Genome. Now there is no genetic tools to work with this bacteria. So let's reduce its genome to the pure minimum (by transposon mutagenesis) and install that in a cellular milieu.
What are the rules for designing genomes?
We never did "transposon mutagenesis", we did however try to strip down a electronic device such as a PacMan game console and tried to harvest some components that should then still be functional. Based on this experience we suggest the following rules for designing:
- Set a goal on what you want to recover (minimal function). Ex: "Cell growth and division"
- Try to identify the main functional units. Ex: Operons..?
- Try to identify the main inter-connections like power lines. Ex: Pathways, regulatory functions
- Cut some of these lines and see if separate units are still working. Isolate the units.
- Now take away components from that units that you think are not so relevant. Keep testing for the main function.
- Work on the powered system and check for effects. Sometimes also reboot completely to see if all is still ok.
Rules based on data analysis.
Many essential genes:
- Protein synthesis
- Biosynthesis of cofactors
- Transcription
Whit these genes you never know:
- Fatty acid and phospholipid metabolism
- Protein fate
- Central intermediary metabolism
- Hypothetical proteins
- Cell envelope
Mostly not essential:
- Amino acid biosynthesis
- Cellular processes
- Mobile and extrachromosomal element functions
- Signal transduction
Notes:
The term "autopoiesis" (from Greek αὐτo- (auto-), meaning "self", and ποίησις (poiesis), meaning "creation, production") refers to a system capable of reproducing and maintaining itself.
Vitalism is an obsolete scientific doctrine that "living organisms are fundamentally different from non-living entities because they contain some non-physical element or are governed by different principles than are inanimate things".
Epigenetics is the study, in the field of genetics, of cellular and physiological phenotypic trait variations that are caused by external or environmental factors that switch genes on and off and affect how cells read genes instead of being caused by changes in the DNA sequence
Systems thinking is not one thing but a set of habits or practices within a framework that is based on the belief that the component parts of a system can best be understood in the context of relationships with each other and with other systems, rather than in isolation. Systems thinking focuses on cyclical rather than linear cause and effect.
An autopoietic machine is a machine organized (defined as a unity) as a network of processes of production (transformation and destruction) of components which: (i) through their interactions and transformations continuously regenerate and realize the network of processes (relations) that produced them; and (ii) constitute it (the machine) as a concrete unity in space in which they (the components) exist by specifying the topological domain of its realization as such a network.
Maturana, Varela, 1980, p. 78
Pictures:
- Coloured scanning electron micrograph (SEM) of a cluster of Mycoplasma genitalium bacteria.
- Serpent Ouroboros.
Fluorescence In Situ Sequencing (FISSEQ)
Lab Homework Assignment
For the homework we were thrilled to see again a hands-on homework assignment and we want to do the in situ sequencing. It sounds quite challenging for a DIY lab as ours. We are not affiliated with any university hence do not have direct access to more complex equipment. So we first tried to get all the materials and equipment. For this we try to optimize the protocol to fit with out DIY approach and see if we can further lower the cost.
Our ideas and questions we asked to our lecturer Evan Daugharthy:
The polyacrylamide gel (PAGE)
We are not equipped for PAGE (also not super fond of having the neurotoxic acrylamide solutions in a home lab .... also the silane stuff is quite smelly ...)
Do you see an alternative to the gel-embedded reaction? I understand that the gel is needed to immobilize the Acrydite-modified splinter (our oligo synthesis service does not even offer Acrydite-modification :-/).
In case we manage to jump into acrylamide, Is Acrydite-modification the only possibility to link the splinter to the gel?
Without acrylamide, Is it possible to somehow just immobilize the DNA on a glass? I am thinking of a procedure used for fixation of cells for immunofluorescence microscopy. Would Paraformaldehyde work (or not ideal due to the crosslinking (and interfering with hybridization))?.
We could immobilize the DNA and run the reaction on a round coverslip, then mount it to a glass slide for microscopy.
How strong is the RCA interaction (the entire complex polymerase, template, circle and amplicon)? would it be possible to run the reaction, stop it and then immobilize everything with paraformaldehyde before labeling the amplicon? Coming from ribosome display I know that eg the ribosome/RNA complex is stable and can be manipulated.
The amplicons can be bound by charge to positively charged glass, e.g. aminosilane treated glass. I believe positively charged glass is sold commercially as well. For RCA in solution, you will have to really experiment with the amount of template and usually RCA for 4 hours but not overnight, as doing it overnight can cause the RCA amplicons to precipitate. I think you can use very very dilute template for in vitro RCA.
Template DNA
instead of ordering a (for our standards ;-)) expensive DNA template, we were thinking of re-using other HTGAA stuff (that future participants should have at hands at this point ;-)). We came up with the M13 ssDNA. Do you see any issues of using such a long DNA as a template?
Yes! The phi29 processivity is limited, so if the template is very large the number of tandem copies in the amplicon will be smaller. Therefore I recommend taking M13 and digesting it with restriction enzymes to get a small fragment (~100 bp) where the ends are known, then make a splint just for that. E.g. find a couple restriction enzymes sites like SmaI where the digestion will give you a small piece with known ends, then just do splint ligation to those ends. You might not even need to isolate the other fragments as there will only be one splint. Remember you need the 5' phosphate on the template also to make ligation go forward. Some restriction enzymes leave a 5'phos, otherwise it is possible to do T4 polynucleotide kinase to add a 5'phos.
Detection of RCAmplicons
instead of directly Fluo-labeling the oligos, we were thinking of using biotinylated oligos (cheaper than Fluo ;-)). The bio-Tag would be much more versatile for detection reagents (which then could be Fuo-labeled Streptavidin). If no Fluo-Microscope is available, even SA-Alkaline Phosphatase could be used with a colored precipitating substrate (of course muliplexing wouldn't be possible any more).
What kind of microscope do we need?
This is fine, actually you can hybridize the first biotinylated oligo, then do detection with one color, then hybridize the other and do detection with the other color. You can also use only 1x fluor-streptavidin molecule if you image in between, just look at the additive signal.
A 400x or even 100x microscope should be good as the amplicons are quite big and bright.
Conclusion for our experiment:
- In stead of the gel we can use the positively charged glass, e.g. aminosilane treated glass and we do not need the Acrydite-modification
- To start we can also try with rolling-circle amplification (RCA) in solution
- Uning M13 is not a good idea (too long), how about staples (with dumbbell)
- In stead of directly Fluo-labeling the oligos, we can use biotinylated oligos
So let's do it!
http://www.menzel.de/Adhesion_Slides.678.0.html?L=1
| Lab Equipement: In Situ Sequencing | ||
| Tools | ||
| - Positive Slides | ? | |
| - Pipettes & Tips (20, 200, 1000 uL) | Sachiko | |
| - Clean glass or plastic beakers (large enough to submerge slides) | ok | |
| - PCR machine or heat block | ok | |
| - Fluorescence microscope | make | |
| - Chemical hood | no needed? | |
| - Optional: 30 deg C incubator | ok | |
| - Optional: Vacuum line for aspiration | ok | |
| Wet ware | ||
| Proof Ethanol, (99.5% Ethanol) | ok | |
| Acetic acid glacial, (99.85% Essigsäure) | ||
| Nuclease-free/Ultrapure H2O e.g. Millipore (Wasser) | Sachiko | |
| Silane ? | not needed? | |
| TEMED ? | not needed? | |
| Ammonium Persulfate (APS) ? | not needed?? | |
| T4 DNA Ligase | ||
| 25 mM dNTP Solution Mix | ||
| Phi29 DNA Polymerase | ||
| DNA Oligonucleotides | ||
Picture: Splint Ligation of Circularize rolling-circle amplification Sequence
Synthetic development biology
The
growth of biological cells is strongly dependent on their
environment. The environmental conditions, such as temperature,
nutrient concentrations, pH, and dissolved gases and even mechanical
and electrical stress affect the growth and productivity of the
organisms. Inside bioreactors the conditions can be defined to obtain
the desired functions. Lecture by: Nina Tandon, MBA, EPIBONE
Assignment: Build a biorector to influence Paramecium by changing the electric field
Setting up a Paramecium Culture
We ordered pure Paramecium caudatum cultures at Sciento.
We also set up different natural pacamecium cultures in PET bottles. For this we collected some grass and water samples from the Lake Lucern. We added baby milk powered, yeast and wheat grains as nutrition. After only a few days we had very vivid cultures with pacamecium and other microorganisms.
How to grow and harvest Paramecium
https://www.youtube.com/watch?v=yn-Do4q6YWQ
DIY PET device to harvest paramecium from culture
Building a Paramecium/Arduino interface
http://making.do/paramecium/index.html
Redesign with an inverted microscope. The webcam is facing up giving better access from the top to the culture chamber.
Experiments with different cultures of Paramecium
Video showing the different organisms and their control as well as a first attempt to track.
Measurements:
(a) Measure how fast the paramecia swimFor the smaller species (l=0.1 mm) we measured (based on video analysis)
t1 = 5.5s ; d1 = 2 mm
t2 = 5s ; d2 = 2 mm
v_avarage_smal l= 0.38mm / s
approximately 4x their body length per second.
For the bigger species ( l= 0.4 mm ):
t1 = 2s ; d1 = 5 mm
t2 = 3s ; d2 = 5 mm
t3 = 4s ; d3 = 5 mm
t4 = 2s ; d4= 5 mm
v_avarage_big = 2.16 mm / s
approx 5 times their body length per second.
(b) Measure the reaction time to change direction in response to electrical stimulation.
The reaction times were so short as they were difficult to determine in a video analysis (< 1s). We installed an object tracking software (Community Core Vision, CCV). With our solid black background and good contrast we were able to track individual species (see video above). The coordinate data of CCV can be read from Pure Data (PD). However we did not get the code right to read out the motion curve of a single species changing direction yet.
Extra Homework:
Attempt to build a Microfluidic Paramecium Sorting Device
based on the electric field reaction:
Flow of Paramecium is separated into two Eppendorf tubes by a microfluidic device.
An electric filed is applied to two electrodes.
Detail of flow chamber.
The effect of separation could be observed. Efficiency was not quantified yet.
Background Links:
“Playing With Life” – Article about wetPONG and biotic games
http://hackteria.org/media/playing-with-life-article-about-wetpong-and-biotic-games/
Wet-Pong initiated by Marc Dusseiller, Hackteria in 2009
http://wetpong.net/
Paramecium/Arduino interface at GenSpace as part of the "global wet pong challege":
http://genspace.org/event/20130321/1900/Arduino%20Wet%20Pong
Daphnia2Midi device and Nyamuk synthesizers:
http://hackteria.org/wiki/DIY_turbidity_meters#BabyTurbiduino_aka_Nyamuk_Synthisaaaiza
Controlling daphnia by light and make them "write poems":
http://www.kapelica.org/index_en.html#event=570
Daphnia aka water fleas are also very nice to work with. they react depending on wavelenghts (blue/red) to light and are easy to grow. also they are already used as full animal biosensors in standardized water quality tests.
http://hackteria.org/wiki/Daphniaology
Many people had trouble with the speed of all these microorganisms. this solves the problem, but i guess there is simple replacements from you kitchen.
Protozoa motility inhibitor:
http://www.sciento.co.uk/catalog/item/582/
Picture: Perfusion + Electric Stimulation for Cardiac Tissue Engineering,
Biofabrication and additive manufacturing
By use of biotechnology, naturally growing materials such as silk can be engineered to new properties. Biofabrication or other technical additive or self-assembling manufacturing processes can be used to bring the materials to new shapes and uses. These materials require low-energy for processing and have little environmental impact.Assignment: Working with silk fibroin
Regeneration of silk fibroin into an aqueous suspension.
We need lithiumbromid. Can we recover it from lithium batteries? Or make it our self?
We finally ordered from ebay.
Where
to get this Slide-A-Lizer (3500). Can we use some other semi-permeable
material for the osmotic separation? Also e-bay (only US)?
Meanwhile...
Silk and Poly Vinyl Alcohol (PVA)
Fabrication of an (edible, implantable, biodegradable) diffraction grating through soft lithography
Experiment with soft lithography using Polydimethylsiloxane (PDMS) to cast a DVD diffraction grating.
1. Separate the layers of a DVD-R (how-to-separate-the-layers-of-a-dvd)
2. Prepare PDMS and degas (using vacuum or centrifugation)
3. Put DVD pieces in cast mold (the inner layers of the DVD hold the diffraction structure)
4. Cast and cure PDMS
5. Carefully remove the pieces of DVD and check the result (surface is iridescent)
Experimenting with Poly Vinyl Alcohol (PVA)
a water-soluble synthetic polymer used to print support structures in 3D printing
Dissolving Poly Vinyl Alcohol in water on a hot plate.
Spinning down the dissolved Poly Vinyl Alcohol sample.
Poured a drop of PVA on the DVD diffraction grating and peeled of after it dried. The iridescent surface also appears on the PVA.
Biomanufacturing in 3D using the silk suspension obtained
Attempt to print Poly Vinyl Alcohol with a 3D printer (Ultimaker). Attached a syringe with a small tube to the printing head of the 3D printer.
Watch the bioprinting movie
Pattern printed with the liquid PVA in a petri dish.
Pattern after drying.
Lifting of the spider net print from the petri dish.
Finally, the lithiumbromid arrived
and we can start the procedure:
The degummed silk is dissolved in the LiBr solution.
The dissolved silk solution was injected in the Slide-A-Lyzer to remove the LiBr.
Dialysis against pure water.
The silk solution was cast on a split piece of DVD.
Silk proteins from a silkworm casted on a DVD to replicate the nano structure.
Links:
More details on Silk Experiment from iGem pages
http://2014.igem.org/Team:UCLA/Project/Spinning_Silk
And great PDF on silk fibroin
http://2014.igem.org/wiki/images/4/4e/Silk_Materials_Protocol_Paper.pdf
Hackteria BioPrinter
http://hackteria.org/wiki/index.php/DIY_Micro_Dispensing_and_Bio_Printing
TED talk by Fiorenzo Omenetto, Silk, the ancient material of the future.
https://www.ted.com/talks/fiorenzo_omenetto_silk_the_ancient_material_of_the_future
Eppendorf Sample order page
https://www.eppendorf.com/int/index.php?&page=1&action=consumables&contentid=1&page=6#
Silk Worm Software
http://www.solidsmack.com/fabrication/project-silkworm-eschews-traditional-slicing-customized-extrusion-3d-printing/
Evolution, CRISPR Gene Drives, and Ecological Engineering
Nature is beautifully evolved and when we do bioengineering we realize that we are not the only ones good at coding. In fact it proved to be quite hard to compete in this hackathon with naturally grown systems. Of course we could end the game and flood the world with our industrial mass production power. But there is one other clever thing that we should try first, the CRISPR Gene Drive.1. We need the tool. Should we get this one, looks ok.
DIY CRISPR Genome Engineering Kits - From The ODIN
https://www.indiegogo.com/projects/diy-crispr-genome-engineering-kits-from-the-odin#/
The guy worked at NASA - hmm
Creative Homework Assignment:
Identify a problem that could be addressed using a CRISPR gene drive.
We consider the use of CRISPR Gene Drives for the "Microbial DNA Cloud Services"
This real world cloud service is using the biosphere and the natural channels provided by it to upload, store and transmit data around the world. Clouds teem with microbes which are transferred worldwide in air masses and water cycle. Data encoded in the microbes DNA using CRISPR Gene Drives can be universally distributed and stored permanently.
See MDNACS Project Page and our Kick-Starter for more info.
Which organism would you target and how would you alter it?
Hundreds of bacteria species are found in the clouds, but Pseudomonas syringae deserves special attention. It thrives in the clouds, with high resistance to UV, cold and salinity, and with an ability to utilize air pollutants as nutrients.
P. syringae is the base for Cloudbac, CloudServices data carrier, a reprogrammed organism carrying encoded data as part of its DNA. P. syringae is highly adaptable to new conditions, it’s high plasticity means that up to 50% of its genome can be exchanged with DNA naturally picked up from the environment, ejecting the old unused information. P. syringae has 6.5 megabases. Since a base can store 2 bits of information, this results in 6.5 megabit or 750 kilobyte storage per bacteria.
Why is a gene drive a good solution relative to other options?
The big amount of extra data stored in the bacteria might make it less fit and reduce the chance to the contained information to be passed on. With a gene drive we could counter balance this effect and make sure data is stored safe and durably.
What could go wrong? Don't go into detail, but list several possibilities.
- Loss of Biodiversity
- Effect on oceans and sea
- Pollution of air, water and soil by chemical compounds
- Climate change
See here.
Design a basic but evolutionarily stable gene drive that should function in your organism.
By Rüdiger Trojok:
Engineering the Human Gut Microbiome
You are not alone. 100 trillion microorganisms live only in your gut. We are gigantic spaceships inhabited by bacteria that might play a role in our health and development, from nutrition, to disease, and even cognition.Assignment
1. Culture a bacterial strain in 3D printed tubes of different materials
We printed the suggested design of test tube in ABS. Unfortunately the tubes were leaking and could not be used to culture. Even a redesign with thicker walls did not work. Maybe we need a new 3D printer at some point. So we decided to use standard polystyrene tubes and put pieces of different materials in the cultures to test.
3D printed test tubes.
Samples of different materials were added to the culture tubes.
Bacteria used: Escherichia coli
Concentrations measured through absorption by DIY turbidity meeter.
Conclusion: The different materials show only little difference in growth. PLA is slightly reducing grow of the Ecoli. The PVA turbidity measurement is most probably perturbated by the dissolving of the material in the liquid.
2. Fabricate your device, or at least one component of your device
Real samples of organs on a chip - cells in wells. (by Marc Dusseiller)
Concept:
Replicate skin or skin structure in a microfluidic device to simulate the culture of microbiome microorganisms in a controlled device.
Different pictures of skin structures
Sketches of possible organ on a chip microfluidic devices. Replpicating a breast to simulate breastfeeding.
Device 1: Chicken skin in a microfluidic device.
Chicken.
Stretching out a piece of chicken skin on a acrylic device.
Finished device with chicken skin.
Device 2: Silicon cast of human skin structure
Casting the skin structure with 2 component silicon.
Skin structure. Cast of skin structure (click on image for bigger view).
Finished device with skin structure.
Breastfeeding Baby On A Chip
Links:
How to cast silicon: GyePunk Dildomancy @HLab 2014
Computational protein design, biosensors and the protein-folding game
After years of working in the field of DNA and DNA expression the new field of proteomics gaind interest. With the rising power of computing for calculating complex simulations and new ways of using collaborative problem solving such as distributed gamification unprecedented solutions could be find in the complex field of protein structure prediction and design. We heard about tool sets and methodes to do model predicitons even on regular personal computers.Assignement:
Calculate the stucture of given proteines using a software called AbinitioRelax. Then visualize and compare model energies.
First we registered and downloaded a education version of PyMol - a 3D visualization tool.
Then we set the paramters for AbinitioRelax and started a simulation.
Protein under simulation: 1TTZ (choosen form a given set)
The tool started the process of aproximation by calculating different model configurations. The configurations and associated foling energies were output to the files S_0000000x.pdb score.fsc respectively.
After 178 minutes on a Mac Pro the calculation finished.
1. Plot the score (or energy) vs rms plot. Rms stands for root mean square deviation. These are two columns in the score.fsc file. Compare that with the energy vs rms plots I showed in my slides.
The score plot looks like this:
Model 73 shows the lowest energy level.
2. Pick the lowest energy model and structurally compare it to the native. How close is it to the native? If its different, what parts did the computer program get wrong? You'll have to compare the structures using a Viewer like pymol or chimera or rasmol.
We then ploted the structure in PyMOL with this result:
A model of the real proteine looks somehow differen:
Source : http://www.ebi.ac.uk
What is wrong? Did we choose the wrong visualization.
3. Pick the lowest rms model and structurally compare it to the native. How close is it to the native? If its different, how is it different? Remember that in a blind case, we will not have the benefit of an rms column.
For the lowest RMS value we found 7.21 with the model S_0000022.
Also the Model rendering of Number 22 looks quite different from the real model found in the database.
We are quite confident that the calculation and determination of the energy models are correct. However the representation seems to be different.
Tool Chains, Automation, and Open Hardware
Synthetic biology requires great hardware. With Julie Legault (Amino) and Will Canine (Opentrons)Assignement: Design and build a piece of open hardware for biology.
Built 1: DIY 3D Printed Bio-Reactor (by Marc Dusseiller)
In his efforts to make a the Euglena Burger - half animal and half plant - Marc worked hard on open source DIY bio-reactors.
A bioreactor is a device or system that supports growth or other desired function of a biologically active organisms by creating optimum conditions.
Eppendorf offers a nice range of "disposable" bioreactors. Can we make our own with 3D printing?
Setup of a DIY bioreactor with pump, stirrer, light and vessels.
Fully customizable bioreactor lid with different ports. (download)
3D printed stirrer (download) and tube clip (download).
More infos here:
http://hackteria.org/wiki/Euglena_Burger
Built 2: DIY Slide-A-Lyzer
For the silk experemiment we used a comercial product called "Slide-A-Lyzer" to dialyze the liquid. If you do not have this fancy piece of equipement you can just use dialysis tubing.
Or make your own open source slide a lyzer.
All you need is some slides. You can easily laser cut them from acrylic. 4 holes in the corner. One hole (you want to drill that by hand) from the top on one slide.
Then you need a semipermeable membrane . You can get a comercial lab grade membrane with the right molecular weight cut-off (MWCO) or we just took some cellophane foil. Note: most of the cookies are packet in similar looking polyethylene (PE) bags. If you want the semipermeable effect make sure to get true cellophane bags.
Screw the three layers of acrylic together with two layers of cellophane in between. To make sure everything is tight you can add some silicone or other sealent.
DIY Slide-A-Lyzer in action. And it seemd to work.
Standard Dimensions of comercial Slide-A-Lyzers:
https://tools.thermofisher.com/content/sfs/brochures/TR0054-SAL-dimensions.pdf
Instruction on how to use them:
https://www.funakoshi.co.jp/data/datasheet/PCC/66453.pdf
Here the 3-12 ml model in real dimensions:
Open SlideALyzer
Download the .dwg files here.
Some of our favorites on HTGAA:
Pairis, great idea."I thought I should start compiling a [synthetic biology glossary]"
http://bio.academany.org/labs/paris/romain-di-vozzo_week_3_htgaa_synthetic-minimal-cells_kate-adamala_sept_9_2015.md
http://git.fabcloud.io/fablabdigiscope/htgaa_2015/blob/master/romain-di-vozzo_synthetic-biology_glossary.md
Providence,
Shawn Wallace:Nice Nupac Rendering...
http://bio.academany.org/labs/providence/shawn_wallace//
Sitges, LOL, thanks:
Last week was about Next Generation Synthesis. Almost no one really did the assignments. Assignment number one only the Swiss as I can see. They look really proficient, they have quite a equipped bio lab and they know what their are doing. Not like us. Assignment number two, no one did it. http://bio.academany.org/labs/sitges/students/sanchez.francisco/w05.html
Cambridge, Show me your lab...
https://www.facebook.com/media/set/?set=a.1171415822874100.1073741894.206373716044987&type=3
Baltimore, nice equipment inventory ;-)
Ah, 400 Liter Fermenter for bio-production still to come.
http://bio.academany.org/labs/baltimore/inventory.html
Paris, "Let’s say that writing DNA is the exact same thing as writing a language"
Poetic text and nice reading with Georg Church.
Text and Video
Providence, Nadya Bedford, great summary of each week.
What happend to you when brainstorming for final project ideas :-)
http://bio.academany.org/labs/providence/nadya_bedford/index.html
Toscana, great list of links about DIY Biology and books
http://bio.academany.org/labs/toscana/
Cambridge, hidden homework folder with interesting content by Mary Tsang
http://maggic.ooo/How-To-Grow-Almost-Anything-2015
Guests on HTGAA
HTGAA with special guest Felix Bänteli from Labor Lucern.
HTGAA with special guest Rüdiger Trojok from Berlin.
Short Hackteria network exchange, Paula Pin, Marry Maggic, Aiki H Hase and Urs Gaudenz during the HTGAA break.
Special Guest Marc Dusseiller presenting Wet-Pong
Visit at Hackuarium Lausanne, Special guests: art and design students from HEAD class.
HTGAA live from RandeLab | Forest Geeking and Beyond
Special guest Gian (aka super_gain) visiting HTGAA.
Live from the BioCommons Meetup Berlin 2016
With BioFlux, DigiBio, BentoLabs, Critical Engineering, TheCellCraftProject and many more.